View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14035_high_17 (Length: 325)
Name: NF14035_high_17
Description: NF14035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14035_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 19 - 319
Target Start/End: Complemental strand, 55321377 - 55321080
Alignment:
| Q |
19 |
atgatctcaagtcagttatccttgcacaataaggtaaattaattttgaatgtctaatctttcttagatgtatagtgcagtggaaatttggagtctttaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55321377 |
atgatctcaagtcagttatccttgcacaataaggtaaattaattttgaatgtctaatctttcttagatgtatagtgcagtggaaatttggagtctttaga |
55321278 |
T |
|
| Q |
119 |
atgaacgaaaagtagcttgcttttctcttggttagcaccatttttatttcgattgtcatgatagccccagtattattacttgattagtattatttgttta |
218 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55321277 |
atgaatgaaaagtagcttgcttttctcttggttagcaccatttttatttcgattgtc---atagccccagtattattacttgattagtattatttgtttg |
55321181 |
T |
|
| Q |
219 |
atgttatagtgatttatagtgtctttcaagctataatatattagttttgttgtttttaaattacagactgaaatagtttctcccaaaaagtagtataatc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
55321180 |
atgttatagtgatttatagtgtctttcaagctataatatattagttttgttgtttttaaattacagactgaaatagtttctcccaaaaagtaatataatc |
55321081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University