View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14035_high_21 (Length: 255)
Name: NF14035_high_21
Description: NF14035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14035_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 80 - 235
Target Start/End: Complemental strand, 7744172 - 7744021
Alignment:
| Q |
80 |
taagaagcaatactcagaagataatgattttcatagatatgttcagaagcaataaatagagtacaacattttagcaagataattttttacagaagaaact |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7744172 |
taagaagcaatactcagaagataatgattttcatagatatgttcagaagcaataaatagagtacaacattttagcaagataattttttacagaagaaact |
7744073 |
T |
 |
| Q |
180 |
aaacaagcaataacaataatagatgtgcaactaagggttggcttgtttagaggctg |
235 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7744072 |
aaacaaacaataacaataatagatgtgcaactaag----ggcttgtttagaggctg |
7744021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 11 - 55
Target Start/End: Complemental strand, 7744241 - 7744197
Alignment:
| Q |
11 |
gagaattcattcagaaggtgagaacaaaaacatttgtaacggagc |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7744241 |
gagaattcattcagaaggtgagaacaaaaacatttgtaacggagc |
7744197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University