View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14035_low_16 (Length: 332)

Name: NF14035_low_16
Description: NF14035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14035_low_16
NF14035_low_16
[»] chr4 (1 HSPs)
chr4 (218-316)||(45544958-45545056)


Alignment Details
Target: chr4 (Bit Score: 99; Significance: 8e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 218 - 316
Target Start/End: Complemental strand, 45545056 - 45544958
Alignment:
218 tacagaaaactactcactttgcatgttgctcgtgcaagatctgagcagcagattttgaaaccatgtccagcttcggcttcaaaacaatcccagcagtag 316  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45545056 tacagaaaactactcactttgcatgttgctcgtgcaagatctgagcagcagattttgaaaccatgtccagcttcggcttcaaaacaatcccagcagtag 45544958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University