View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14036_low_3 (Length: 236)
Name: NF14036_low_3
Description: NF14036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14036_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 14 - 217
Target Start/End: Original strand, 40526593 - 40526796
Alignment:
| Q |
14 |
aagcaaaggctaattttannnnnnnatctggtttccttgttttggaaagaagtattaactaactaattcaaagaactaagtgtaataaagagaaaacagt |
113 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40526593 |
aagcaaaggctaattttatttttttatctggtttccttgttttggaaagaagtattaactaactaattcaaagaactaagtgtaataaagagaaaacagt |
40526692 |
T |
 |
| Q |
114 |
gaaaattttggagtaataggagggaagtcatcttcacaaacctgcatgtgttaatcacgtacacataacatactctttctttctctttcacaaaatgaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40526693 |
gaaaattttggagtaataggagggaagtcatcttcacaaacctgcatgtgttaatcacgtacacataacatactctttctttctctttcacaaaatgaaa |
40526792 |
T |
 |
| Q |
214 |
gtaa |
217 |
Q |
| |
|
|||| |
|
|
| T |
40526793 |
gtaa |
40526796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University