View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14037_low_12 (Length: 353)
Name: NF14037_low_12
Description: NF14037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14037_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 21 - 345
Target Start/End: Complemental strand, 16920009 - 16919686
Alignment:
| Q |
21 |
tggaaccttgttcataaagtttccatccctatgcaggagatagaagatgatctggtttggacacatacaacaaatggtagtttatcttttaaggatgctt |
120 |
Q |
| |
|
||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
16920009 |
tggaatcttgttcacaaagttaccatccctatgcaggagatagaagatgatctggtttggacacatacaacaaatggaagcttatcttttaaggatgctt |
16919910 |
T |
 |
| Q |
121 |
ataagtttaaagacaccccttcccagtctattcaatgggccaaaactatttggtctccaaacattccccctatcaaaatctctgcttgcatggagattaa |
220 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16919909 |
atgagtttaaagacaccccttcccagtctattcaatgggccaaaactatctggtctccaaacattccccc-atcaaaatctctgcttgcatggagattaa |
16919811 |
T |
 |
| Q |
221 |
tgaacgataaaatcccagttgatgagaacctaaaagatagaggatgccatttgccttcagtttgcagtctttgcatggtttcggaggaaacgatttttca |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
16919810 |
tgaacgataaaatcccagttgatgagaacctaaaagatagaggatgtcatttgccttcagtttgcagtctttgcatggtttctgaggaaacggcttttca |
16919711 |
T |
 |
| Q |
321 |
ccttttctttgattgtccctatgct |
345 |
Q |
| |
|
||| |||||||||||||| |||||| |
|
|
| T |
16919710 |
cctattctttgattgtccttatgct |
16919686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University