View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14037_low_17 (Length: 302)
Name: NF14037_low_17
Description: NF14037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14037_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 159 - 288
Target Start/End: Complemental strand, 3222348 - 3222219
Alignment:
| Q |
159 |
tataaagtatataattgtcttaggcaccaacttgttctgaaagcaatatgtaactgcgtgttgcacaccaagttgaaaataattgtttctgtctcaacag |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3222348 |
tataaagtatataattgtcttaggcaccaacttgttctgaaagtaatatgtaactgcgtgttgcacaccaagttgaaaataattgtttttgtctcaacag |
3222249 |
T |
|
| Q |
259 |
tcaacacaagaataaaaaatagtttcttgt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3222248 |
tcaacacaagaataaaaaatagtttcttgt |
3222219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 159 - 288
Target Start/End: Complemental strand, 3281130 - 3281001
Alignment:
| Q |
159 |
tataaagtatataattgtcttaggcaccaacttgttctgaaagcaatatgtaactgcgtgttgcacaccaagttgaaaataattgtttctgtctcaacag |
258 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3281130 |
tataaagtatataattgtgttaggcaccaacttgttctgaaagcaatatgtaactgcgtgttgcacaccaagttgaaaataattgtttttgtctcaacag |
3281031 |
T |
|
| Q |
259 |
tcaacacaagaataaaaaatagtttcttgt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3281030 |
tcaacacaagaataaaaaatagtttcttgt |
3281001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University