View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14037_low_23 (Length: 258)
Name: NF14037_low_23
Description: NF14037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14037_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 39 - 234
Target Start/End: Complemental strand, 30173908 - 30173713
Alignment:
| Q |
39 |
aatatcttgtaaaagaacaagtgaatcatgtaaatatttatatacctgatggaatctcggatgaacttttccatttagatttgcaaattgcggaattgaa |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30173908 |
aatatcttgtaaaagaacaagtgaatcatgtaaatatgtatatacctgatggaatctcggatgaactcttccatttagatttgcaaattgcggaattgaa |
30173809 |
T |
 |
| Q |
139 |
gccaagattcactaatcgatcgcatatttctgtaagcaaacatttccggcagctcaccaccggttgccggcacaagcatagcatctcagacatgtt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30173808 |
gccaagattcactaatcgatcgcatatttctgtaagcaaacatttccggcagctcaccaccggttgccggcacaagcatagcatctcagacatgtt |
30173713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 46 - 180
Target Start/End: Complemental strand, 12360133 - 12359999
Alignment:
| Q |
46 |
tgtaaaagaacaagtgaatcatgtaaatatttatatacctgatggaatctcggatgaacttttc-catttagatttgcaaattgcggaattgaagccaag |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||| ||||| ||||||| | |
|
|
| T |
12360133 |
tgtaaaagaacaagtgaatcatgtaaatatgtatatacctgatggaatctcggatgaactaccctaatttagatttgcaaattccggaaatgaagcc-ac |
12360035 |
T |
 |
| Q |
145 |
attcactaatcgatcgcatatttctgtaagcaaaca |
180 |
Q |
| |
|
||||| ||| |||| ||||||||| | |||||||| |
|
|
| T |
12360034 |
attcaacaattgatcacatatttctctgagcaaaca |
12359999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University