View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14037_low_26 (Length: 242)
Name: NF14037_low_26
Description: NF14037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14037_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 225
Target Start/End: Original strand, 15885466 - 15885677
Alignment:
| Q |
14 |
aaggtaaaatattaaagttacaacaaaacacattatcagcatgttttgtgatttaagaattcaaggaagttctattctctatgaaaccagataaatgcct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15885466 |
aaggtaaaatattaaagttacaacaaaacacattatcagcatgttttgtgatttaagaattcaaggaagttctattctctatgaaaccagataaatgcct |
15885565 |
T |
|
| Q |
114 |
tggacaggatggattcgatccaagattctttcaaaacaattggtcgagatatggagatgaaatttgtaatcaatggtgtggttggcttttgacatgtatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15885566 |
tggacaggatggattcgatccaagattctttcaaaacaattggtcgagatatggagatgaaatttgtaatcaatggtgtggttggcttttgacatgtatt |
15885665 |
T |
|
| Q |
214 |
ttcccatcaacc |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15885666 |
ttcccatcaacc |
15885677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University