View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14037_low_27 (Length: 239)
Name: NF14037_low_27
Description: NF14037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14037_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 221
Target Start/End: Complemental strand, 6854888 - 6854681
Alignment:
| Q |
14 |
atgaatgatatggacgtgtcatgctcatctttgttgcttattgaagacagtgcagattctgaaggtgaacttattggtttctttactctctaccctgctg |
113 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6854888 |
atgaatgatatggatgtatcatgctcatctttgttgcttattgaagacagtgcagattctgaaggtgaacttattggtttctttactctataccctgctg |
6854789 |
T |
|
| Q |
114 |
ctaattactttgggcacaaggaagatgatgctgagtcatgcacctatgagtgtgacaacgatggtatgtgtagcatagttaaggaaaatgaagatgataa |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6854788 |
ctaattactttgggcataaggaagatgatgctgagtcatgcacctatgagtgtgacaacgatggtatgtgtagcatagttaaggaaaatgaagatgataa |
6854689 |
T |
|
| Q |
214 |
agggtcag |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
6854688 |
agggtcag |
6854681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 14 - 220
Target Start/End: Complemental strand, 6861667 - 6861461
Alignment:
| Q |
14 |
atgaatgatatggacgtgtcatgctcatctttgttgcttattgaagacagtgcagattctgaaggtgaacttattggtttctttactctctaccctgctg |
113 |
Q |
| |
|
|||||||||||||| || ||||| |||||| | ||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
6861667 |
atgaatgatatggatgtatcatgttcatctctattgcttattgaggacagtgcagattctgaaggtgaccttattggcttctttactctataccctgctg |
6861568 |
T |
|
| Q |
114 |
ctaattactttgggcacaaggaagatgatgctgagtcatgcacctatgagtgtgacaacgatggtatgtgtagcatagttaaggaaaatgaagatgataa |
213 |
Q |
| |
|
|||||||| | ||||||||||| || |||||||||||||| |||||||||||||||| |||| ||||| | | | ||||||||| |||| ||||||| |
|
|
| T |
6861567 |
ctaattacatagggcacaaggaggaggatgctgagtcatgtacctatgagtgtgacatagatgatatgtatgacttggttaaggaagatgacaatgataa |
6861468 |
T |
|
| Q |
214 |
agggtca |
220 |
Q |
| |
|
||||||| |
|
|
| T |
6861467 |
agggtca |
6861461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University