View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14038_high_26 (Length: 324)
Name: NF14038_high_26
Description: NF14038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14038_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 307
Target Start/End: Original strand, 15508828 - 15509133
Alignment:
| Q |
1 |
attgggttgggttggtgaatttagaagcaataatggaattgacaagaaccggttgtgcggttatttatgtcatcctcctttgtgctttggctcaaggggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15508828 |
attgggttgggttggtgaatttagaagcaataatggaattgacaagaaccggttgtgcggttatttatgtcatcctcctttgtgctttggctcaaggggg |
15508927 |
T |
 |
| Q |
101 |
ctcagaggggaaggaagatgagctttgtatagaagattcttcttttttatctttcattcatattcatatttatggaaaacaggtacatttatgtatttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15508928 |
ctcagaggggaaggaagatgagctttgtatagaagattcttcttttttatctttcattcatattcatatttatggaaaacaggtacatttatgtatttca |
15509027 |
T |
 |
| Q |
201 |
taggtttttcttttatattaatccactgcaaatgcgtcccnnnnnnnnnnnnnnntcgccgtagttaaggctttgtacgatgttattgatgatatccacg |
300 |
Q |
| |
|
|| ||||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15509028 |
tacgtttttcttttatattaatccaccgcaaatgcgtccc-aaaaaaataaaaaatcgtcgtagttaaggctttgtacgatgttattgatgatatccacg |
15509126 |
T |
 |
| Q |
301 |
acttagg |
307 |
Q |
| |
|
||||||| |
|
|
| T |
15509127 |
acttagg |
15509133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University