View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14038_high_41 (Length: 227)
Name: NF14038_high_41
Description: NF14038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14038_high_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 213
Target Start/End: Original strand, 11613731 - 11613928
Alignment:
| Q |
16 |
ttctgggggtgctgcttcaaccggtgaacctgccaaaaggaagcgtggaaggcctagaaaatacggggctgatggaagtgtgtccttagcattgactcca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11613731 |
ttctgggggtgctgcttcaaccggtgaacctgccaaaaggaagcgtggaaggcctagaaaatacggggctgatggaagtgtgtccttagcattgactcca |
11613830 |
T |
 |
| Q |
116 |
acaacaccagcaagccatcatggaacggtaccgcaagtccagaaacgcggtcgagggcgccctccagggtccgggaaaaaacaacagttggcttcttt |
213 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11613831 |
acaacaccagcaagccatcctggaaccgtaccgcaagtccagaaacgcggtcgagggcgccctccagggtccgggaaaaaacaacagttggcttcttt |
11613928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University