View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14038_low_26 (Length: 338)
Name: NF14038_low_26
Description: NF14038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14038_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 12 - 298
Target Start/End: Complemental strand, 9736845 - 9736574
Alignment:
| Q |
12 |
atgaagactcatttagacatcatcaaatagtttttgatgaccttataaaatctaagaaatctgaggaaaccnnnnnnnn--atctcatgaactttttgtc |
109 |
Q |
| |
|
||||||||||| ||||||| ||||| |||| ||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
9736845 |
atgaagactcagttagacaccatcatatagcttttgatgaccttataaaatctaagaaatcttaggaaaccttttttttttatctcatgaactttttgtc |
9736746 |
T |
 |
| Q |
110 |
tcttgtattttaattttctcagtattttaaatatacaagtatttctttttgttgatggaaaatgggggagtagaagtagtattttattaactgctaaaat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9736745 |
tcttgtattttaattttctcagtattttatatatacgagtatttctttttgttgatggaaaatgggggagtagaagtagtatttta-------------- |
9736660 |
T |
 |
| Q |
210 |
tgtttatcttgcagaatttatattgtttcttaatacttatatgcttattatgtgataattaacctggcttagacttaggggagcttaca |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9736659 |
---ttatcttgcagaatttatattgtttcttaatacttatatgcttattatgtcataattaacctggcttagacttaggggagcttaca |
9736574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University