View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14038_low_42 (Length: 233)
Name: NF14038_low_42
Description: NF14038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14038_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 1779733 - 1779935
Alignment:
| Q |
18 |
ttcttatggcaagcttgtcacaactagtctctccccaacagacgtatcttgtgacatccggggggtttcatctaacaacaacttgctcgttctcaatgtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1779733 |
ttcttatggcaagcttgtcacaactagtctctccccaacagacgtatcttgtgacatccggggggtttcatctaacaacaacttgctcgttctcaatgtc |
1779832 |
T |
 |
| Q |
118 |
ttatattatgtccttacgctgttgagattttgattacttgcggggttcatgatgttcaaacaaagtctcacggtattgacttcatgttagtagttgtagt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1779833 |
ttatattatgtccttacgctgttgagattttgattacttgcggggttcatgatgttcaagcaaagtctcacggtattgacttcatgttagtagttgtagt |
1779932 |
T |
 |
| Q |
218 |
tga |
220 |
Q |
| |
|
||| |
|
|
| T |
1779933 |
tga |
1779935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University