View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14039_high_18 (Length: 261)
Name: NF14039_high_18
Description: NF14039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14039_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 13 - 248
Target Start/End: Original strand, 8211940 - 8212175
Alignment:
| Q |
13 |
aaaataagctcagtggaaaaatacctgatttgggttctcttgaaaatctttactacatggatcttagtaataatggattttccggtgacccgtttggatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8211940 |
aaaataagctcagtggaaaaatacctaatttgggttctcttgaaaatctttactacatggatcttagtaataatggattttccggtgacccgtttggatt |
8212039 |
T |
|
| Q |
113 |
tccggcgtctttggttcagatttcaatgaggaacaataatttaagcggtggtttagcttctgaaagcttcaagaatttgaattatctgcaggttgtggat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8212040 |
tccggcgtctttggttcagatttcaatgaggaacaataatttaagtggtagtttagcttctgaaagcttcaagaatttgaattatctgcaggttgtggat |
8212139 |
T |
|
| Q |
213 |
ttcagttcaaacaaaattaatggctatgttccttct |
248 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8212140 |
ttcagttcaaacaaaatcaatggctatgttccttct |
8212175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University