View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14039_high_7 (Length: 537)
Name: NF14039_high_7
Description: NF14039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14039_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 254 - 528
Target Start/End: Complemental strand, 36406345 - 36406071
Alignment:
| Q |
254 |
taactcctgttcctaagcaaaggtagataattaccgttgggagtattttgatcagtttggttgcctgtgagcaaagaatagatgtctaaagagcaatttt |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36406345 |
taactcctgttcctaagcaaaggtagataattaccgttgggagttttttgatcagtttggttgcctgtgagcaaagaatagatgtctaaagagcaatttt |
36406246 |
T |
 |
| Q |
354 |
cttatacttaaaagcataaatagcccacttcgggaaagtcatctttttgttttctgggtccactaatttcagttgggcttgatgtgggttttgagaagaa |
453 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36406245 |
cttatacttaaaagcataaatagcccacttcgggaaagtcatctttttgttttctgggtccactaatttcagttgggcttgatgtgggttttgagaagaa |
36406146 |
T |
 |
| Q |
454 |
acaactatacaaaagccccccaaatacaactatactagctttgttctttttatcatttaactttttacacctttg |
528 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36406145 |
acaactatacaaaagccccccaaatacaactatactagctttgttctttttatcatttcactttttacacctttg |
36406071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 55 - 92
Target Start/End: Complemental strand, 26684327 - 26684290
Alignment:
| Q |
55 |
accatagagaaggaaaatttggagaaacatataactat |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26684327 |
accatagagaaggaaaatttggagaaacataaaactat |
26684290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 318 - 354
Target Start/End: Original strand, 24084165 - 24084201
Alignment:
| Q |
318 |
ctgtgagcaaagaatagatgtctaaagagcaattttc |
354 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
24084165 |
ctgtgagcaaagcataggtgtctaaagagcaattttc |
24084201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University