View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14039_low_15 (Length: 341)
Name: NF14039_low_15
Description: NF14039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14039_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 4 - 333
Target Start/End: Original strand, 44381193 - 44381522
Alignment:
| Q |
4 |
cgctgttggcgtcaggaactgggattgttgttctgtttcgctatgttctcgggttaccggaattcgggttgatacgatggaggggttttgcaggattctt |
103 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44381193 |
cgctgttggcgtcagtaactgggattgttgttctgtttcgctatgttctcgggttactggaattcgggttgatacgatggaggggttttgcaggattctt |
44381292 |
T |
 |
| Q |
104 |
gctgggaaaggttggaccttttttaaaacgaaggaaaacccttctgtggatcactgtggtggaggtgttgtataccttttcaggaaggttgatgtgaacc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44381293 |
gctgggaaaggttggaccttttttaaaacgaaggaaaacccttctgtggatcactgtggtggaggtgttgtataccttttcaggaaggttgatgtgaacc |
44381392 |
T |
 |
| Q |
204 |
gggttcgagtgggtcgggttggagcacctgatggggcttgtagagtgagggaactgaggttgcctcatttggattttgaaaatgctcctttgaggatttt |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44381393 |
gggttcgagtgggtcgggttggagcacctgatggggcttgtagagtgagggaactgaggttgcctcatttggattttgaaaatgctcctttgaagatttt |
44381492 |
T |
 |
| Q |
304 |
gcagtatattttgttgatgactgatgatgt |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44381493 |
gcagtatattttgttgatgactgatgatgt |
44381522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University