View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14039_low_18 (Length: 290)
Name: NF14039_low_18
Description: NF14039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14039_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 177 - 277
Target Start/End: Original strand, 44381067 - 44381167
Alignment:
| Q |
177 |
aaaccacgccattccgattccttttccttcttttgccacaacgccattgacacatcttcgtttctttgttaccctcttcccacgtgccttcaagcttgtt |
276 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44381067 |
aaaccacgccgttcccattccttttccttctttttccacaacgccattgacacatcttcgtttctttgttaccctcttcccacgcgccttcaagcttgtt |
44381166 |
T |
|
| Q |
277 |
c |
277 |
Q |
| |
|
| |
|
|
| T |
44381167 |
c |
44381167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University