View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14039_low_21 (Length: 246)
Name: NF14039_low_21
Description: NF14039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14039_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 5 - 226
Target Start/End: Complemental strand, 14577144 - 14576923
Alignment:
| Q |
5 |
cgagagagaagaaaataatcatgcacttgaggcttgtaccttattaacctgccacattgcattttttgtatggtatatttattaactattcatgatttct |
104 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14577144 |
cgagagacaagaaaataatcatgcacttgaggcttgtaccttattaacctgccacattgcattttttgtatggtatatttattaactattcatgatttct |
14577045 |
T |
|
| Q |
105 |
ttaaattcatacttttcttagagtttgttataccttatataactataaattaaaaatcatacaaaaatcattgtgacccatgtgctactaccgtcgagtg |
204 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14577044 |
ttaaattcatacttttcttagagtttgctataccttatataactataaattaaaaatcatacaaaaatcattgtgacccatgtgctactaccgtcgagtg |
14576945 |
T |
|
| Q |
205 |
tatgtactatgtgcatgcatag |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
14576944 |
tatgtactatgtgcatgcatag |
14576923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 94 - 134
Target Start/End: Complemental strand, 35467283 - 35467243
Alignment:
| Q |
94 |
tcatgatttctttaaattcatacttttcttagagtttgtta |
134 |
Q |
| |
|
||||||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
35467283 |
tcatgatttctttaaatccataattttcttaaagtttgtta |
35467243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University