View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1403_low_11 (Length: 334)
Name: NF1403_low_11
Description: NF1403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1403_low_11 |
 | |
|
| [»] scaffold0010 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 94 - 257
Target Start/End: Complemental strand, 6165020 - 6164857
Alignment:
| Q |
94 |
atgttcaaaaataatcatgacagtagcaaatttcatggacacaacgttagctgtcacaaaaatcacaatatggtcccaaaaatgagcatctgaggactcg |
193 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
6165020 |
atgttcaaaaataaacatgacaatagcaaatttcatggacacaaccttagctgtcacaaaaatcacaatatggtccaaaaaatgagcatctgaggactag |
6164921 |
T |
|
| Q |
194 |
ttgcggcaatgtggtttctagatgcagtctatatggtttgacaaatgaaacctctatttataat |
257 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6164920 |
ttgctgcaatgtggtttctagatgcagtctatatggtttgacaaatgaaacctctatttataat |
6164857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 176 - 251
Target Start/End: Original strand, 148525 - 148600
Alignment:
| Q |
176 |
tgagcatctgaggactcgttgcggcaatgtggtttctagatgcagtctatatggtttgacaaatgaaacctctatt |
251 |
Q |
| |
|
||||||| ||||||||| | | ||| ||||||||||||||| ||||| | ||||||||| |||||||||||||| |
|
|
| T |
148525 |
tgagcatttgaggactcatggttgcattgtggtttctagatgtagtctttgtggtttgacggatgaaacctctatt |
148600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University