View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1403_low_17 (Length: 309)
Name: NF1403_low_17
Description: NF1403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1403_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 46 - 280
Target Start/End: Complemental strand, 49962070 - 49961836
Alignment:
| Q |
46 |
acatcatctgtatctctaggtgcttttggtacttcaagaatacatcatctagtttcacactttgtctacttcaagatcgtttgttttcacaaggagcaca |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49962070 |
acatcatctgtatctctaggtgcttttggtacttcaagaatacatcatctagtttcacactttgtctacttcaagatcgtttgttttcacaaggagcaca |
49961971 |
T |
|
| Q |
146 |
ttaaagacaattgattagataaaattatggtatgaggttttacaacgccaaaatcttcatctctcaattttaactttgatcaaaattcgtacaaaagaca |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49961970 |
ttaaagacaattgattagataaaattatggtatgaggttttacaacgccaaaatcttcagctctcaattttgactttgatcaaaattcgtacaaaagaca |
49961871 |
T |
|
| Q |
246 |
tatgtgaatttcaaatccttacatagggaattagg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
49961870 |
tatgtgaatttcaaatccttacatagggaattagg |
49961836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University