View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1403_low_18 (Length: 308)
Name: NF1403_low_18
Description: NF1403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1403_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 87 - 205
Target Start/End: Complemental strand, 45276848 - 45276730
Alignment:
| Q |
87 |
aatatcaactttggaactcgaacttttgcgaccaaccagtaaatcaaaacgttaacagccactgaaccacttagcacattaataaaatggggcaatttat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
45276848 |
aatatcaactttggaactcgaacttttgcgaccaaccagtaaatcaaaacgttaacagccactgcaccacttagcacattaataaaatgggacaatttat |
45276749 |
T |
|
| Q |
187 |
ttttgttaatatggcttat |
205 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45276748 |
ttttgttaatatggcttat |
45276730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University