View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1403_low_35 (Length: 253)
Name: NF1403_low_35
Description: NF1403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1403_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 5 - 243
Target Start/End: Complemental strand, 45706612 - 45706374
Alignment:
| Q |
5 |
tcagttcatttgcgcatatacttgtatgtttatttgtttcagttaattaagcggtattcatcatcagtatagtaaataagagaattataattatacatga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45706612 |
tcagttcatttgcgcatatacttgtatgtttatttgtttcagttaattaagcggtattcatcatcagtatagtaaataagagaattataattatacgtga |
45706513 |
T |
 |
| Q |
105 |
gttattagattatcactaatcaactttttacgctctataattgcagcatcagcaagaagatgaagctagcacaacattgatccgattattatatctttca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45706512 |
gttattagattatcactaatcaactttttacgctctataattgcagcatcagcaagaagatgaagctagcacaacattgatccgattattatatctttca |
45706413 |
T |
 |
| Q |
205 |
ataattttctttctgttaatgtatttgtagtgagaatta |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45706412 |
ataattttctttctgttaatgtatttgtagtgagaatta |
45706374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University