View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1403_low_36 (Length: 251)
Name: NF1403_low_36
Description: NF1403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1403_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 37558456 - 37558216
Alignment:
| Q |
1 |
acgatttcagtttcggtttttcctaaacacactcaggattattgctagtaaatcaaagaaaaatccagtagcttcactaacactcatatccgttacttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37558456 |
acgatttcagtttcggtttttcctaaacacactcaggattattgctagtaaatcaaagaaaaatccagtagcttcactaacactcatatccgttacttca |
37558357 |
T |
 |
| Q |
101 |
gaccatggatacggcttcactggttttgttgcttcaagaagaatctccaatggaatctttggttttgacctttccataggaaccgtgtaatgatagtatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37558356 |
gaccatggatacggcttcactggttttgttgcttcaagaagaacctccaatggaatctttggttttgacctttccataggaaccgtgtaatgatagtatt |
37558257 |
T |
 |
| Q |
201 |
tctctgggtctggacaaagatcctgcagaatttcacctttg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37558256 |
tctctgggtctggacaaagatcctgcagaatttcacctttg |
37558216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University