View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1403_low_39 (Length: 220)

Name: NF1403_low_39
Description: NF1403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1403_low_39
NF1403_low_39
[»] chr8 (1 HSPs)
chr8 (107-220)||(39793431-39793544)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 107 - 220
Target Start/End: Original strand, 39793431 - 39793544
Alignment:
107 ctctccctgcaacaggtttgtttctacttcccacaaaaatgggactgagcacaactaaagatcccatcatacgaagtggtaggttgccaagaaaacccta 206  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
39793431 ctctccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgccaagaaaaaccta 39793530  T
207 cgtttaccgccgct 220  Q
    |  |||||||||||    
39793531 caattaccgccgct 39793544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University