View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14040_high_40 (Length: 243)
Name: NF14040_high_40
Description: NF14040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14040_high_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 22 - 226
Target Start/End: Complemental strand, 34675800 - 34675579
Alignment:
| Q |
22 |
cactattattggagtggtccnnnnnnntttaatgttttttactccaccttattgtaacacaaaaacttcaatggaaaacattatactaagcaatgtatt- |
120 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675800 |
cactattattggagtggtccaaaaaaagttaatgctttttactccaccttattgtaacacaaaaacttcaatggaaaacattatactaagcaatgtattt |
34675701 |
T |
 |
| Q |
121 |
----------------ctcttaatgcattgatttatttattttatttaaatttcagttcagtcgttgcaacttacaaacccataatgatttgattacatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675700 |
ttgcatgctgtgtattctcttaatgcattgatttatttattttatttaaatttcagttcagtcgttgcaacttacaaacccataatgatttgattacatt |
34675601 |
T |
 |
| Q |
205 |
tatttattttatcgaaatttca |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34675600 |
tatttattttatcgaaatttca |
34675579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University