View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14040_high_43 (Length: 239)
Name: NF14040_high_43
Description: NF14040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14040_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 11 - 224
Target Start/End: Original strand, 3087612 - 3087834
Alignment:
| Q |
11 |
atattaaattttatcaatccaaccgtcaaattaaaagttctcattgagtatatctactcgacaacttgctataaagtctttaaactaaatt-tcctttat |
109 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||| ||||||||| ||||| |||||||||| | |||||| |
|
|
| T |
3087612 |
atattaaattttatcaatccaaccgtcgaattaaaagttctcattaagtatatcaactcgacaaattgctataaggtcttcaaactaaattatactttat |
3087711 |
T |
 |
| Q |
110 |
gaaacaaatttgaacgaacatactctcatattacatagctacgaatgttagatttat--------gagagagagatcgcaaattattacctttgagcggt |
201 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3087712 |
gaaacaaattcaaacgaacatactctcatattacatagccacgaatgttatatttatgagagaaagagagagagatcgcaaattattacctttgagcggt |
3087811 |
T |
 |
| Q |
202 |
gttagacctttgtcaaatattgt |
224 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3087812 |
attagacctttgtcaaatattgt |
3087834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 74
Target Start/End: Original strand, 4623161 - 4623217
Alignment:
| Q |
18 |
attttatcaatccaaccgtcaaattaaaagttctcattgagtatatctactcgacaa |
74 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||||||| |||| |||| |
|
|
| T |
4623161 |
attttatcaatccaaccgtcaaattaaaaattcttattgagtatatcaactcaacaa |
4623217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University