View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14040_high_44 (Length: 236)
Name: NF14040_high_44
Description: NF14040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14040_high_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 46752471 - 46752681
Alignment:
| Q |
18 |
tcagaaagcttcagtgcatggtcactatttggattggaaccttctttgcaatcatggctgttaatactagctgatacagttgttaatgaagctactgata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46752471 |
tcagaaagcttcagtgcatggtcactatttggattggaaccttctttgcaatcatggctgttaatactagctgatacagttgttaatgaagctgctgata |
46752570 |
T |
 |
| Q |
118 |
ttttgttttattctaaattctaaaagatcttttttcagctaaattttatataaataaatctatcaatcttttagatttttgtgggtgcaatcttaccaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752571 |
ttttgttttattctaaattctaaaagatcttttttcagctaaattttatataaataaatctatcaatcttttagatttttgtgggtgcaatcttaccaga |
46752670 |
T |
 |
| Q |
218 |
acccttcatct |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
46752671 |
acccttcatct |
46752681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University