View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14040_low_10 (Length: 527)
Name: NF14040_low_10
Description: NF14040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14040_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 6171191 - 6170977
Alignment:
| Q |
18 |
ttaaatgtccctgaatgaattgatcttttttgcgaaattggtgacggttgagcttgagcaacggccgatttaggttgtgtttgtttgtcgggtgtttggt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6171191 |
ttaaatgtccctgaatgaattgatcttttttgcgaaattggtgacggttgagcttgagcaacgaccgatttaggttgtgtttgtttgtcgggtgtttggt |
6171092 |
T |
 |
| Q |
118 |
tttcgttgccctactggttatgtcttgctctggtactcacgagtttttgctattggtgtttttaagttgcggtctccctctttaacctttgcacgttgga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6171091 |
tttcgttgccctactggttatgtcttgctctggtactcacgagtttttgctattggtgtttttaagttgcggtctccctctttaacctttgcacgttgga |
6170992 |
T |
 |
| Q |
218 |
gtttatatctcttcg |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
6170991 |
gtttatatctcttcg |
6170977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 305 - 522
Target Start/End: Complemental strand, 6170904 - 6170687
Alignment:
| Q |
305 |
atgtatattttgtttataattnnnnnnntgcatatgatctactcacttggctaatgacaaatttccaccgaagtttttgattgaaccaccccacctttat |
404 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6170904 |
atgtatattttgtttataattaaaaaaatgcatatgatctactcacttggctaatgacaaatttccaccgaagtttttgattgaaccaccccacctttat |
6170805 |
T |
 |
| Q |
405 |
agtcattttttgtgtctacaaagttcaatttgccacaacccgtgtcttgcattttaaaaattaaaaagatgtcacattaaattgattatttgcttgagct |
504 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6170804 |
agtcattttttgtgtctacaaagttcaatttgccacaacccgtgtcttgcattttaaaaattaaaaagatgtcacattaaattgattatttgcttgagct |
6170705 |
T |
 |
| Q |
505 |
tagtctccttcatttcac |
522 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6170704 |
tagtctccttcatttcac |
6170687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University