View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14040_low_16 (Length: 448)
Name: NF14040_low_16
Description: NF14040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14040_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 5e-94; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 5e-94
Query Start/End: Original strand, 117 - 295
Target Start/End: Original strand, 40175271 - 40175449
Alignment:
| Q |
117 |
tgttgatgttaactaagattaccacgtctatcacttttttcaagaggtttcaaacgatgagaagaagatccattatgaaaattgttgaaaaaaggaacca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40175271 |
tgttgatgttaactaagattaccacgtctatcacttttttcaagaggtttcaaacgatgagaagaagatccattatgaaaattgttgaaaaaaggaacca |
40175370 |
T |
|
| Q |
217 |
aatggttaagaagaagaagttgaataggcaccgaaggcattatgaaatgctcttcgaaaccctccaaatagtttcacac |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40175371 |
aatggttaagaagaagaagttgaataggcaccgaaggcattatgaaatgctcttcgaaaccctccaaatagtttgacac |
40175449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 40175155 - 40175198
Alignment:
| Q |
1 |
atccccgattcttcaaacaatcaacttgtacaacgtttagagca |
44 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40175155 |
atccccgattcttcaaacgatcaacttgtacaacgtttagagca |
40175198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 124 - 188
Target Start/End: Complemental strand, 29397318 - 29397254
Alignment:
| Q |
124 |
gttaactaagattaccacgtctatcacttttttcaagaggtttcaaacgatgagaagaagatcca |
188 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
29397318 |
gttaactaagattaccacgcctatcacttttttcaagatgtttaaaacgatgaaaagaagatcca |
29397254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University