View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14040_low_35 (Length: 272)
Name: NF14040_low_35
Description: NF14040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14040_low_35 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 25264699 - 25264431
Alignment:
| Q |
1 |
tttatctcatgtagtgtcatgtaaccaattccaatcgcttcgtcctatactaacacacattatttagctctcggtataagtaggttaggatagtcgccct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25264699 |
tttatctcatgtagtgtcatgtaaccaa--ccaattgcttcgtcctatactaacacacattatttagctctcggtataagtaggttagg-tagtcgccct |
25264603 |
T |
 |
| Q |
101 |
cccgagagaagtcatatacaccatctctagatctcgaaaatactccaagtacaacaaatcaacatacttggcgctcttatttctcaaagagtggtgccca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25264602 |
cccgagagaagtcatatacaccatctctagatctcgaaaatactccaagtacaacaaatcaacatacttggcgctcttatttctcaaagagaggtgccca |
25264503 |
T |
 |
| Q |
201 |
ccaagaaaagtaggtacatcgtgatggtgtatagtccagtgcaaccattcgctcactttgtcatcattcgca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
25264502 |
ccaagaaaagtaggtacatcgtgatggtgtatagtccagtgcaaccatgcgctcactttgtcgtcattcgca |
25264431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University