View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14040_low_36 (Length: 260)
Name: NF14040_low_36
Description: NF14040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14040_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 2468719 - 2468942
Alignment:
| Q |
18 |
aagacttttttcattgcagtgagtgcacataaatcacttgttattgtgatatttttctcattttcattcttttcaaaccaaatacaaaacaatgaagaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2468719 |
aagacttttttcattgcagtgagtgcacataaatcacttgttattgtgatatttttctcattttcattcttttcaaaccaaatacaaaacaatgaagaaa |
2468818 |
T |
 |
| Q |
118 |
tgaaactgtgatattaaaaaacaataacctcctttctgttaagatttatttgaagaatttggttattgatgagataaaaatgaaaggggaagctctggaa |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | ||| |
|
|
| T |
2468819 |
tcaaactgtgatattaaaaaacaataacctcctttctgttaagatttatttgaagaatttggttattgatgagataaaaatgaagggggaagctgttgaa |
2468918 |
T |
 |
| Q |
218 |
ataagtttgatttgagtgtttgat |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
2468919 |
ataagtttgatttgagtgtttgat |
2468942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University