View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14040_low_46 (Length: 230)
Name: NF14040_low_46
Description: NF14040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14040_low_46 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 7 - 230
Target Start/End: Complemental strand, 40285175 - 40284952
Alignment:
| Q |
7 |
ctttccacttatcatnnnnnnntattattctgaattacactttgtttaagtggagcaaaagagagttaagtgtcgcctttttggtaatggaatggattat |
106 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40285175 |
ctttccacttatcataaaaaaatattattctgaattacactttgttttagtggagcaaaagagtgttaagtgtcgcctttttggtaatggaatggattat |
40285076 |
T |
|
| Q |
107 |
ggaatgagggtgtggaaggttgttagttgttttcatgctcattcaaagcacattactactatctgtttttgtgataaatgaggggttaagttggggaaca |
206 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40285075 |
ggaatgagggtgtggaagtttgtcagttgttttcatgctcattcaaagcacattactactatctgtttttgtgataaatgaggggttaagttggggaaca |
40284976 |
T |
|
| Q |
207 |
taatctttttaaatttccggaatt |
230 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40284975 |
taatctttttaaatttccggaatt |
40284952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University