View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14040_low_47 (Length: 229)
Name: NF14040_low_47
Description: NF14040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14040_low_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 12 - 215
Target Start/End: Complemental strand, 5053890 - 5053687
Alignment:
| Q |
12 |
agtctccgcaacagtattgccacggtaatataagggattttgaagcctccgcaacagtattaccactgtaatataagggaatttaaagtctccacaacag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5053890 |
agtctccgcaacagtattgccacggtaatataagggattttgaagcctccacaacagtattgccactgtaatataagggattttaaagtctccacaacag |
5053791 |
T |
|
| Q |
112 |
tattgcaaccgcaattttgacatcttattcctgcatttttctgcaatataaaggtttgcaacataactagaaccactatatataatctatagttggtagt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053790 |
tattgcaaccgcaattttgacatcttattcccgcatttttctgcaatataaaggtttgcaacgtaactagaaccactatatataatctatagttggtagt |
5053691 |
T |
|
| Q |
212 |
atta |
215 |
Q |
| |
|
|||| |
|
|
| T |
5053690 |
atta |
5053687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 46 - 117
Target Start/End: Complemental strand, 5053899 - 5053828
Alignment:
| Q |
46 |
ggattttgaagcctccgcaacagtattaccactgtaatataagggaatttaaagtctccacaacagtattgc |
117 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| ||||||||||||| ||| ||| ||||||||||||||||| |
|
|
| T |
5053899 |
ggattttgaagtctccgcaacagtattgccacggtaatataagggattttgaagcctccacaacagtattgc |
5053828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University