View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14040_low_48 (Length: 221)

Name: NF14040_low_48
Description: NF14040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14040_low_48
NF14040_low_48
[»] chr7 (2 HSPs)
chr7 (17-206)||(25264821-25265010)
chr7 (43-71)||(25265030-25265058)


Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 17 - 206
Target Start/End: Complemental strand, 25265010 - 25264821
Alignment:
17 atttcttttacccatttcttttactctgaaatgggtgtgtgttgtagtgactgacggaaggggtagaagaaacaatcttgatggagaaaccgatgcaaac 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||    
25265010 atttcttttacccatttcttttactctgaaatgggtgtgtgttgtagtgactggcggaagaggtagaagaaacaatcttgatggagaaaccgatgcaaac 25264911  T
117 attcttgatatggatatgtaactaggtgacccttagtcagaacaaacatattatctcataagtctcgaccctcttagtatgcaggttcat 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25264910 attcttgatatggatatgtaactaggtgacccttagtcagaacaaacatattatctcataagtctcgaccctcttagtatgcaggttcat 25264821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 71
Target Start/End: Original strand, 25265030 - 25265058
Alignment:
43 tgaaatgggtgtgtgttgtagtgactgac 71  Q
    |||||||||||||||||||||||||||||    
25265030 tgaaatgggtgtgtgttgtagtgactgac 25265058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University