View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14040_low_48 (Length: 221)
Name: NF14040_low_48
Description: NF14040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14040_low_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 17 - 206
Target Start/End: Complemental strand, 25265010 - 25264821
Alignment:
| Q |
17 |
atttcttttacccatttcttttactctgaaatgggtgtgtgttgtagtgactgacggaaggggtagaagaaacaatcttgatggagaaaccgatgcaaac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25265010 |
atttcttttacccatttcttttactctgaaatgggtgtgtgttgtagtgactggcggaagaggtagaagaaacaatcttgatggagaaaccgatgcaaac |
25264911 |
T |
 |
| Q |
117 |
attcttgatatggatatgtaactaggtgacccttagtcagaacaaacatattatctcataagtctcgaccctcttagtatgcaggttcat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25264910 |
attcttgatatggatatgtaactaggtgacccttagtcagaacaaacatattatctcataagtctcgaccctcttagtatgcaggttcat |
25264821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 71
Target Start/End: Original strand, 25265030 - 25265058
Alignment:
| Q |
43 |
tgaaatgggtgtgtgttgtagtgactgac |
71 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25265030 |
tgaaatgggtgtgtgttgtagtgactgac |
25265058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University