View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14040_low_50 (Length: 209)
Name: NF14040_low_50
Description: NF14040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14040_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 43231411 - 43231590
Alignment:
| Q |
17 |
aattgatgggtaggagctcatatttaatttactactaaatcaatcaattcaattgttagcatataattaattgaagagatgatttgggtggcgctgtgtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43231411 |
aattgatgggtaggagctcatatttaatttactactaaatcaatcaattcaattgttagcatataattaattgaagagatgatttgggtggcgctgtgtt |
43231510 |
T |
 |
| Q |
117 |
cttgtagtcaaagattagcatttgccgtagagactaagctacaatcaaatgaagcatttgatctcaaccgcatagtatta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||| |
|
|
| T |
43231511 |
cttgtagtcaaagattagcatttgccgtagagactaagctacaatcaaatgacgcatttgatctcaaccgcgtaatatta |
43231590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University