View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14041_high_24 (Length: 225)
Name: NF14041_high_24
Description: NF14041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14041_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 209
Target Start/End: Complemental strand, 35061828 - 35061638
Alignment:
| Q |
19 |
accgcccctggttcctaatgcttgataagttttgattactcataccttgatttgtgatttagagtttgattgaaaaatattttcaaagtttatatttgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35061828 |
accgcccctggttcctaatgcttgataagttttgattactcatatcttgatttgtgatttagagtttgattgaaaaatattttcaaagtttatatttgaa |
35061729 |
T |
 |
| Q |
119 |
ttgaattgcctaatgaattttgttactaggaatagagtttgatgcatgtattgattcctttttaatcatcatcttagtatcagatcctttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35061728 |
ttgaattgcctaatgaattttgttactaggaatagagtttgatgcatgtattgattcctttttaatcatcatcttagtatcagatcgtttg |
35061638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 49 - 120
Target Start/End: Original strand, 33714105 - 33714175
Alignment:
| Q |
49 |
tttgattactcataccttgatttgtgatttagagtttgattgaaaaatattttcaaagtttatatttgaatt |
120 |
Q |
| |
|
|||||| ||||||| |||||||| ||||||||| ||||||| |||||||| || |||| |||||||||||| |
|
|
| T |
33714105 |
tttgatcactcatatcttgattt-tgatttagaagttgattggaaaatattatctaagtctatatttgaatt |
33714175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University