View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14041_low_25 (Length: 223)
Name: NF14041_low_25
Description: NF14041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14041_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 38 - 208
Target Start/End: Complemental strand, 52770623 - 52770451
Alignment:
| Q |
38 |
ttgaagcaatgcaaattagattactaaaactgagtaaatgtcaagaataagatagaa---aacttagctcaaaactagaaaatttattttcaataaaaat |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52770623 |
ttgaagcaatgcaaattagattactaaaactgagtaaatgtcaagaataagatagaagaaaacttagctcaaaactagaaaatttattttcaatcaaaat |
52770524 |
T |
|
| Q |
135 |
tctctctatttaagtattggaaactttactagcaacttagtaattcactgactagtggtatggttatggtattc |
208 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
52770523 |
tctctctattttagtattggaaactttactagcaactttgtaattcactgactagtggtatgg-tatggtattc |
52770451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University