View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14041_low_25 (Length: 223)

Name: NF14041_low_25
Description: NF14041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14041_low_25
NF14041_low_25
[»] chr1 (1 HSPs)
chr1 (38-208)||(52770451-52770623)


Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 38 - 208
Target Start/End: Complemental strand, 52770623 - 52770451
Alignment:
38 ttgaagcaatgcaaattagattactaaaactgagtaaatgtcaagaataagatagaa---aacttagctcaaaactagaaaatttattttcaataaaaat 134  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||| |||||    
52770623 ttgaagcaatgcaaattagattactaaaactgagtaaatgtcaagaataagatagaagaaaacttagctcaaaactagaaaatttattttcaatcaaaat 52770524  T
135 tctctctatttaagtattggaaactttactagcaacttagtaattcactgactagtggtatggttatggtattc 208  Q
    ||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||    
52770523 tctctctattttagtattggaaactttactagcaactttgtaattcactgactagtggtatgg-tatggtattc 52770451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University