View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14042_high_21 (Length: 295)
Name: NF14042_high_21
Description: NF14042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14042_high_21 |
 | |
|
| [»] scaffold0075 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0075 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: scaffold0075
Description:
Target: scaffold0075; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 295
Target Start/End: Original strand, 16772 - 17066
Alignment:
| Q |
1 |
tttcattgatgaaggcgagttttttcttcacacgaagagcatgctacatggaacgactccatgcgaggtacttacaaccattaagctttggagaaacaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16772 |
tttcattgatgaaggcgagttttttcttcacacgaagagcatgctacatggaacgactccatgcgaggtagttacaaccattaagctttggagaaacaac |
16871 |
T |
|
| Q |
101 |
aacaaaattcaatcattcacttagatgcacatagaagatcgaatcagaatcaggttgttgaagataagggaaacttaacatggaggcataatgacgagta |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16872 |
aacaaaattcaaacattcacttagatgcacatagaagatcgaatcagaatcaggttgttgaagataagggaaacttaacatggaggcataatgacgagta |
16971 |
T |
|
| Q |
201 |
agaaattaaatcaatcaaagaaaacaagatggatttgtgtagaaatcacctaaaaaatgaagattaaaactgtcattttcaaaaacaagatggat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
16972 |
agaaattaaatcaatcaaagaaaacaagatggatttgtgtagaaatcacctaaaaaatgaagattaaaactgtcatctttaaaaacaagatggat |
17066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University