View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14042_low_21 (Length: 307)
Name: NF14042_low_21
Description: NF14042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14042_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 19 - 295
Target Start/End: Original strand, 7542286 - 7542562
Alignment:
| Q |
19 |
gatttagccttttgactataaccctcttccttaattttctctcatcaaattcttcacttgtctcaatctcacactaatcaaatgaaacaacctgctgcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542286 |
gatttagccttttgactataaccctcttccttaattttctctcatcaaattcttcacttgtctcaatctcacactaatcaaatgaaacaacctgctgcaa |
7542385 |
T |
|
| Q |
119 |
aatcatcattaaggaggttatgtccaaacatagacaaagaagatggattggaaactgttcttgaaatacctatacctgaagaaatgttttcaaacatggg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542386 |
aatcatcattaaggaggttatgtccaaacatagacaaagaagatggattggaaactgttcttgaaatacctatacctgaagaaatgttttcaaacatggg |
7542485 |
T |
|
| Q |
219 |
aagtaatgtgacattaagatggcaaaatatgttaacatggatgaaggctcaaactgaggataaattgtcttccccta |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542486 |
aagtaatgtgacattaagatggcaaaatatgttaacatggatgaaggctcaaactgaggataaattgtcttccccta |
7542562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University