View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14042_low_30 (Length: 263)
Name: NF14042_low_30
Description: NF14042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14042_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 246
Target Start/End: Complemental strand, 45357678 - 45357446
Alignment:
| Q |
14 |
atatcacactctttgtgcttactgcttttatttcgtaatctttgatacataaattcatttgccaaacgaaacatggcaacaacaataatagtcccatccc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45357678 |
atatcacactctttgtgcttactgcttttatttcgtaatctttgatacataaattcatttgccaaacgaaacatggcaacaacaataatagtcccatccc |
45357579 |
T |
 |
| Q |
114 |
ccctttcttttcggagaattgnnnnnnnctagcatcttatcagccaattcacacaaaaacctaaaatattggttccatgtttgttacatctttcaggttc |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45357578 |
ccctttcttttcggagaattgtttttttctagcatcttatcagccaattcacacaaaaacctaaaatattggttccatgtttgttacatctttcaggttc |
45357479 |
T |
 |
| Q |
214 |
agcgagttgggatgggtatttacttgcactatc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45357478 |
agcgagttgggatgggtatttacttgcactatc |
45357446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University