View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14042_low_33 (Length: 249)
Name: NF14042_low_33
Description: NF14042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14042_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 26710777 - 26710591
Alignment:
| Q |
18 |
gtatcagagtaggtctgtccattctaaccatgtgggtcatgtgttagtcttgcatctattgtgtttatgtacatccttgttaatattttgaattgttttc |
117 |
Q |
| |
|
||||||||| |||||||| ||||| | | |||||||||||||| |||||||||||| |||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
26710777 |
gtatcagagcaggtctgttcattcagatcgtgtgggtcatgtgtcagtcttgcatctgttgtgtttgtgtacatccttcttaatattttgaattgttttc |
26710678 |
T |
 |
| Q |
118 |
cctttgtttgttttgaattcttgtaagttgtgagatatgatgatgatgatatgactcgaaccttcgaagcattgatcatcacccata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26710677 |
cctttgtttgttttgaattcttgtaagttgtgagatatgatgatgatgatatgactcaaaccttcgaagcattgatcatcacccata |
26710591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University