View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14042_low_34 (Length: 249)
Name: NF14042_low_34
Description: NF14042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14042_low_34 |
 |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0036 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 138 - 233
Target Start/End: Complemental strand, 10390 - 10295
Alignment:
| Q |
138 |
gtttcgcgctaaattgtgcgagttggaatcgcactgaagactgaattcgactgctcggaaaacgtcgccggagttcgccgtcggccaccagaaaca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10390 |
gtttcgcgctaaattgtgcgagttggaatcgcactgaagactgaattcgactgctcggaaaacgtcgccggagttcgccgtcggccaccagaaaca |
10295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 71
Target Start/End: Complemental strand, 10511 - 10456
Alignment:
| Q |
16 |
agtttaatatgaagcccgttccacnnnnnnngaagggcccatcattcaccaagccc |
71 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
10511 |
agtttaatatgaagcccgttccactttttttgaagggcccatcattcatcaagccc |
10456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University