View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14042_low_35 (Length: 248)
Name: NF14042_low_35
Description: NF14042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14042_low_35 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 141 - 248
Target Start/End: Complemental strand, 37170213 - 37170106
Alignment:
| Q |
141 |
gatactaataattattgaggatgaaatgggagaaataggaagggtgggagagagcatccatcatgtttgtcaactaaagttgtttgttgcagccaaaata |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37170213 |
gatactaataattattgaggatgaaatgggagaaataggaagggtggcagagagcatccatcatgtttgtcaactaaagttgtttgttgcagccaaaata |
37170114 |
T |
|
| Q |
241 |
gattattc |
248 |
Q |
| |
|
|||||||| |
|
|
| T |
37170113 |
gattattc |
37170106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 54
Target Start/End: Complemental strand, 37170331 - 37170303
Alignment:
| Q |
26 |
acatgaatccattttgtttgttggtcctg |
54 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37170331 |
acatgaatccattttgtttgttggtcctg |
37170303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University