View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14042_low_38 (Length: 243)
Name: NF14042_low_38
Description: NF14042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14042_low_38 |
 |  |
|
| [»] scaffold1019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 16 - 169
Target Start/End: Original strand, 32489854 - 32490007
Alignment:
| Q |
16 |
attatactagaaatggctgacttccaagagattatcttattattaaaccttacacctctagtgcattggaaatatccttgagctttctcattcacataaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32489854 |
attatactagaaatggctgacttccaagagattatcttattattgaaccttacacctttagtgcattggaaatatccttgagctttctcattcacataaa |
32489953 |
T |
 |
| Q |
116 |
tagagagaaatgctgatttaagaataacatcaatccaattgtagaaagtatcat |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32489954 |
tagagagaaatgctgatttaagaataacatcaatccaattgtagagagtatcat |
32490007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1019 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold1019
Description:
Target: scaffold1019; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 114 - 179
Target Start/End: Original strand, 702 - 767
Alignment:
| Q |
114 |
aatagagagaaatgctgatttaagaataacatcaatccaattgtagaaagtatcattcaaaccaaa |
179 |
Q |
| |
|
|||||||||||| ||||| || ||||| |||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
702 |
aatagagagaaaggctgactttagaatcacatcaatccaattacagaaaacatcattgaaaccaaa |
767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University