View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14045_low_11 (Length: 268)
Name: NF14045_low_11
Description: NF14045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14045_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 33363149 - 33362908
Alignment:
| Q |
13 |
aatatcaagatacctgtaatataagaaaccctagattagtagctagtgcacatgctctctcttttatatcaatgatgaagctcatcattttcatgaaatg |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33363149 |
aatagcaagatacctgtaatataagaaaccctagattagtagctagtgcacatgctctctcttttatatcaatgatgaagctcatcgttttcatgaaatg |
33363050 |
T |
 |
| Q |
113 |
aacaacatcatgaagatttatattcatttagggacgttttggtgatcacccttctgctg-aaacaaagagg----aattaagttataaccnnnnnnnnnn |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
33363049 |
aacaacatcatgaagatttatattcatttagggacgttttagtgatcacccttctgctgaaaaaaaagaggaattaattaagttataaccaaaaaaagat |
33362950 |
T |
 |
| Q |
208 |
nnnncaaagaaattaagtttaagtactaattaatgatatttt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33362949 |
aaaacaaagaaattaagtttaagtactaattaatgatatttt |
33362908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University