View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14046_high_21 (Length: 258)
Name: NF14046_high_21
Description: NF14046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14046_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 28439684 - 28439919
Alignment:
| Q |
1 |
ctttgtttatagcactcgagctccaaatactcatggtgtttaaaacacctgcattgtttagaatgaatttggaaaaacttatgtcccgctttaggtccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28439684 |
ctttgtttatagcactcgagctccaaatactcatggtgtttaaaacacctgcattgtttagaatgaatttggaaaaacttatgtcccgctttaggtccat |
28439783 |
T |
|
| Q |
101 |
agctccaaaatcacggatagagcagcttatgagatgtgatccaatacatggtggaacggatgctgggtccacccatgcttctggcagttcgcactcatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28439784 |
agctccaaaatcacggatagagcagcttatgagatgtgatccaatacatggtggaacggatgctgggtccacccatgcttctggcagttcgcactcatta |
28439883 |
T |
|
| Q |
201 |
acttgtggtaagtacaatggcggagggggcagatgg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28439884 |
acttgtggtaagtacaatggcggagggggcagatgg |
28439919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University