View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14046_high_6 (Length: 452)
Name: NF14046_high_6
Description: NF14046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14046_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 6e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 351 - 431
Target Start/End: Original strand, 2601217 - 2601297
Alignment:
| Q |
351 |
ttaattaacatctattggctttgctttggtgtcatgtcatgtttctagcatattgactctagtaagataaaatgaataatc |
431 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2601217 |
ttaattaacatctattggctttgctttggtgtcatgtcatgtttctagcatattgactctagtaagataaaatgaataatc |
2601297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 426
Target Start/End: Original strand, 2614680 - 2614748
Alignment:
| Q |
351 |
ttaattaacatctattggctttgctttggtgtcatgtcatgtttctagcatattgactctagtaagataaaatgaa |
426 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
2614680 |
ttaattaacatctatcggctttgctttgg-----tgtcatgtttctaccatattga--ctagtaagataaaatgaa |
2614748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University