View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14046_low_15 (Length: 301)
Name: NF14046_low_15
Description: NF14046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14046_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 14 - 288
Target Start/End: Original strand, 3908144 - 3908429
Alignment:
| Q |
14 |
gcaaagggtaaaagatcgccgttgttttggtcaaggtagattttgatattaattttgcagagacaagtagaagaatttcttaattcagactcaaaa---- |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3908144 |
gcaaagggtaaaagatcgccgttgttttggtcaaggtagattttcatattaattttgcagagacaagtagaacaatttcttaattcagactcaaaaaaat |
3908243 |
T |
 |
| Q |
110 |
-------aatcaaacttttcaaacacttttcccttaatagttgaatcgtaagaaaaaccagaaaccaaccaatagcagtagcaaccggtttttgttttgt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3908244 |
ccgaaaaaatcaaacttttcaaacacttttcccttaatggttgcatcgtaagaaaaaccagaaaccaaccaatagcagtagcaaccggtttttgttttct |
3908343 |
T |
 |
| Q |
203 |
tatttttgattataaatatggcacgtctctgtttagaaaacgcacactcaaataaaaactgagagatggagcaagaaagtggagat |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3908344 |
tatttttgattataaatatggcacgtctctgtttagaaaacgcacactcaaataaaaactgagagatggagcaagaaagtggagat |
3908429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University