View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14046_low_26 (Length: 243)
Name: NF14046_low_26
Description: NF14046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14046_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 225
Target Start/End: Complemental strand, 41221515 - 41221305
Alignment:
| Q |
15 |
atgaacaaaacacactttggaacctcgcgagcaaaacatttatggcatcgacaatccttgctagttaagcagaacacgcgatctgtgatgagaataacta |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41221515 |
atgaacaaaaaacactttggaacctcgcgagcgaaacatttatggcatcgacaatccttgctagttaagcagaacacgcgatctgtgatgagaataacta |
41221416 |
T |
|
| Q |
115 |
taaagagatgagcgattatgtatatcgtaaagaacaaaatttaaaacaggtgtaaaaagaacttaccgttgctggtcacaagaacaattagagaaagaaa |
214 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41221415 |
taaagagatgagtgattatgtaaatcgtaaagaacaaaatttaaaacaggtgtaaaaagaacttaccgttgctggtcacaagaacaattagagaaagaaa |
41221316 |
T |
|
| Q |
215 |
gataatcaaag |
225 |
Q |
| |
|
||||||||||| |
|
|
| T |
41221315 |
gataatcaaag |
41221305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University