View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14046_low_32 (Length: 205)
Name: NF14046_low_32
Description: NF14046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14046_low_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 9 - 191
Target Start/End: Complemental strand, 5690809 - 5690628
Alignment:
| Q |
9 |
gacatcatcaaaggaattcggcaatcggttgtttagatgatagtgtaaataagttttacactaagcatgaattaaaattaannnnnnnggagattacctc |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5690809 |
gacataatcaaaggaattcggcaatcggttatt-agatgatagtgtaaataagttttacactaagcatgaattaaaattaatttttttggagattacctc |
5690711 |
T |
 |
| Q |
109 |
attagaatagttttatttatatctccatcataaaaactcctttaacttgtgcatgattaacaaataatcatgccataaacttg |
191 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5690710 |
atcagaagagttttatttatatctccatcataaaaactcctttaactagtgcatgattaacaaataatcatgccataaacttg |
5690628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University